Review



pbluescript sk ii (+) vector plasmid  (Agilent technologies)


Bioz Verified Symbol Agilent technologies is a verified supplier
Bioz Manufacturer Symbol Agilent technologies manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Agilent technologies pbluescript sk ii (+) vector plasmid
    Pbluescript Sk Ii (+) Vector Plasmid, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+sk+ii+(+)+vector+plasmid/pm39082859-55-10-16
    Average 90 stars, based on 1 article reviews
    pbluescript sk ii (+) vector plasmid - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: X Ray-Induced Insulinoma Cell Line Rin-5F Has a Novel Mutation Site, C.A1459G (P.T487A), in Death Domain Associated Protein (DAXX) Gene
    Article Snippet: In order to facilitate sub-cloning into the pBlueScript II SK (+) vector (Stratagene, Santa Clara, California), XhoI and EcoRI sites were incorporated into the primer at the 5' and 3' ends, respectively, for Exon 1-7 and the cDNA of the DAXX gene.

    Article Title: Affinity-tagged SMAD1 and SMAD5 mouse lines reveal transcriptional reprogramming mechanisms during early pregnancy
    Article Snippet: The reference plasmids containing PA tag sequence were constructed in pBluescript II SK (+) vector (Agilent, Palo Alto, CA, USA).

    Article Title: Cell Type-Specific Promoters of Volvox carteri for Molecular Cell Biology Studies.
    Article Snippet: To construct the expression vector pPCY1-Luc, four fragments were required: the PCY1 promoter region (Vocar.0015s0197), the G. princeps luciferase gene (G-Luc) [73], the Lhcbm1 terminator region (Vocar.0001s0479), and the pBluescript II SK (-) vector (Agilent Technologies, Santa Clara, CA, USA) as a backbone.

    Article Title: Crystal structure reveals the binding mode and selectivity of a photoswitchable ligand for the adenosine A 2A receptor.
    Article Snippet: The cDNA region of human A2AR was amplified from human spleen marathonready cDNA library (Clontech) by nested PCR method, and the coding sequence of A2AR was cloned into EcoRV restriction site of pBluescript II SK(+) vector (Stratagene).

    Article Title: Reprogramming somatic cells into pluripotent cells using a vector encoding Oct4 and Sox2
    Article Snippet: All genomic fragments and the cassette were cloned into the multiple cloning site (MCS) of a cloning vector, pBluescript® SK II (GenBank Accession Number X52328; Stratagene; La Jolla, CA).

    Clone Assay:

    Article Title: Brain-specific glycosylation enzyme GnT-IX maintains levels of protein tyrosine phosphatase receptor PTPRZ, thereby mediating glioma growth.
    Article Snippet: Plasmids All PCR steps were performed using Tks Gflex DNA Polymerase (TaKaRa). .. Human PTPRZ-long (6948 bp) was cloned by real-time PCR using total RNA from LN-229 cells with the primers 5′-GGAATTCGATATCAAATGCGAATCCTAAAGCGTTT-3′ (forward) and 5′- ACGGTATCGATAAGCTTTAAACTAAAGACTCTAAG-3′ (reverse) and subcloned into the EcoRV site of the pBluescript II SK vector (Stratagene) using an In-Fusion HD Cloning Kit (TaKaRa). .. For C-terminal sPTPRZ754-His, extracellular regions of PTPRZ-long after the signal peptide were amplified using PCR with the primers 5′-CCGGCCAGATCTCCCTACTACAGACAACAGAGAAA-3′ (forward) and 5′- CGTCGACCTGCAGCCTTAGTGATGGTGGTGATGATGGTGGTGATGATGATTGTATACCGGTTGGGT-3′ (reverse) and inserted between the SmaI and SacII sites of pDisplay (Thermo Fisher Scientific).

    Real-time Polymerase Chain Reaction:

    Article Title: Brain-specific glycosylation enzyme GnT-IX maintains levels of protein tyrosine phosphatase receptor PTPRZ, thereby mediating glioma growth.
    Article Snippet: Plasmids All PCR steps were performed using Tks Gflex DNA Polymerase (TaKaRa). .. Human PTPRZ-long (6948 bp) was cloned by real-time PCR using total RNA from LN-229 cells with the primers 5′-GGAATTCGATATCAAATGCGAATCCTAAAGCGTTT-3′ (forward) and 5′- ACGGTATCGATAAGCTTTAAACTAAAGACTCTAAG-3′ (reverse) and subcloned into the EcoRV site of the pBluescript II SK vector (Stratagene) using an In-Fusion HD Cloning Kit (TaKaRa). .. For C-terminal sPTPRZ754-His, extracellular regions of PTPRZ-long after the signal peptide were amplified using PCR with the primers 5′-CCGGCCAGATCTCCCTACTACAGACAACAGAGAAA-3′ (forward) and 5′- CGTCGACCTGCAGCCTTAGTGATGGTGGTGATGATGGTGGTGATGATGATTGTATACCGGTTGGGT-3′ (reverse) and inserted between the SmaI and SacII sites of pDisplay (Thermo Fisher Scientific).

    Article Title: Association of oral fungal profiles with health status and bacterial composition in elderly adults receiving community support and home care service.
    Article Snippet: Fungi compose a minority but a common component of normal oral microbiota and contribute to oral and systemic health by interacting with bacterial inhabitants.. This study investigated the relationship of oral fungal profiles to health status and bacterial profiles of 159 elderly adults receiving community support and home care services.. Fungal and bacterial densities and compositions were determined based on the fungal ribosomal internal transcribed spacer region and bacterial 16S rRNA gene amplicon analyses, respectively.

    Plasmid Preparation:

    Article Title: Brain-specific glycosylation enzyme GnT-IX maintains levels of protein tyrosine phosphatase receptor PTPRZ, thereby mediating glioma growth.
    Article Snippet: Plasmids All PCR steps were performed using Tks Gflex DNA Polymerase (TaKaRa). .. Human PTPRZ-long (6948 bp) was cloned by real-time PCR using total RNA from LN-229 cells with the primers 5′-GGAATTCGATATCAAATGCGAATCCTAAAGCGTTT-3′ (forward) and 5′- ACGGTATCGATAAGCTTTAAACTAAAGACTCTAAG-3′ (reverse) and subcloned into the EcoRV site of the pBluescript II SK vector (Stratagene) using an In-Fusion HD Cloning Kit (TaKaRa). .. For C-terminal sPTPRZ754-His, extracellular regions of PTPRZ-long after the signal peptide were amplified using PCR with the primers 5′-CCGGCCAGATCTCCCTACTACAGACAACAGAGAAA-3′ (forward) and 5′- CGTCGACCTGCAGCCTTAGTGATGGTGGTGATGATGGTGGTGATGATGATTGTATACCGGTTGGGT-3′ (reverse) and inserted between the SmaI and SacII sites of pDisplay (Thermo Fisher Scientific).

    Article Title: Association of oral fungal profiles with health status and bacterial composition in elderly adults receiving community support and home care service.
    Article Snippet: Fungi compose a minority but a common component of normal oral microbiota and contribute to oral and systemic health by interacting with bacterial inhabitants.. This study investigated the relationship of oral fungal profiles to health status and bacterial profiles of 159 elderly adults receiving community support and home care services.. Fungal and bacterial densities and compositions were determined based on the fungal ribosomal internal transcribed spacer region and bacterial 16S rRNA gene amplicon analyses, respectively.

    Cloning:

    Article Title: Brain-specific glycosylation enzyme GnT-IX maintains levels of protein tyrosine phosphatase receptor PTPRZ, thereby mediating glioma growth.
    Article Snippet: Plasmids All PCR steps were performed using Tks Gflex DNA Polymerase (TaKaRa). .. Human PTPRZ-long (6948 bp) was cloned by real-time PCR using total RNA from LN-229 cells with the primers 5′-GGAATTCGATATCAAATGCGAATCCTAAAGCGTTT-3′ (forward) and 5′- ACGGTATCGATAAGCTTTAAACTAAAGACTCTAAG-3′ (reverse) and subcloned into the EcoRV site of the pBluescript II SK vector (Stratagene) using an In-Fusion HD Cloning Kit (TaKaRa). .. For C-terminal sPTPRZ754-His, extracellular regions of PTPRZ-long after the signal peptide were amplified using PCR with the primers 5′-CCGGCCAGATCTCCCTACTACAGACAACAGAGAAA-3′ (forward) and 5′- CGTCGACCTGCAGCCTTAGTGATGGTGGTGATGATGGTGGTGATGATGATTGTATACCGGTTGGGT-3′ (reverse) and inserted between the SmaI and SacII sites of pDisplay (Thermo Fisher Scientific).

    Control:

    Article Title: Association of oral fungal profiles with health status and bacterial composition in elderly adults receiving community support and home care service.
    Article Snippet: Fungi compose a minority but a common component of normal oral microbiota and contribute to oral and systemic health by interacting with bacterial inhabitants.. This study investigated the relationship of oral fungal profiles to health status and bacterial profiles of 159 elderly adults receiving community support and home care services.. Fungal and bacterial densities and compositions were determined based on the fungal ribosomal internal transcribed spacer region and bacterial 16S rRNA gene amplicon analyses, respectively.



    Similar Products

    93
    Addgene inc pbluescript sk ii vector
    Pbluescript Sk Ii Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+sk+ii+(+)+vector+plasmid/pBluescript+SK+%2B%2F-+mTRF1+(Plasmid+%2312303)/pmc12378376-105-30-33
    Average 93 stars, based on 1 article reviews
    pbluescript sk ii vector - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Agilent technologies pbluescript sk ii (+) vector plasmid
    Pbluescript Sk Ii (+) Vector Plasmid, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+sk+ii+(+)+vector+plasmid/pm39082859-55-10-16
    Average 90 stars, based on 1 article reviews
    pbluescript sk ii (+) vector plasmid - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Agilent technologies pbluescript ii sk(+) plasmid vector
    Pbluescript Ii Sk(+) Plasmid Vector, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+sk+ii+(+)+vector+plasmid/pm37497849-111-13-18
    Average 90 stars, based on 1 article reviews
    pbluescript ii sk(+) plasmid vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher pbluescript ii sk (+) plasmid vector
    Pbluescript Ii Sk (+) Plasmid Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+sk+ii+(+)+vector+plasmid/pmc04115231-48-5-11
    Average 90 stars, based on 1 article reviews
    pbluescript ii sk (+) plasmid vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Agilent technologies pbluescript ii sk- plasmid vector
    Pbluescript Ii Sk Plasmid Vector, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+sk+ii+(+)+vector+plasmid/pmc04143246-134-14-19
    Average 90 stars, based on 1 article reviews
    pbluescript ii sk- plasmid vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Agilent technologies pbluescript ii sk− plasmid vector
    Pbluescript Ii Sk− Plasmid Vector, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+sk+ii+(+)+vector+plasmid/pm10373629-62-17-24
    Average 90 stars, based on 1 article reviews
    pbluescript ii sk− plasmid vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results